Skip to main content

Table 1 Primers used in the amplification of lac and tmr genes from Stenotrophomonas maltophilia isolate TPMD-1

From: Decolorization of Malachite green dye by Stenotrophomonas maltophilia a compost bacterium

Primers Sequences References
Lac F
Lac R
5′ATGTCCTTTACCCGTCGACAAATGC 3'
5′TCAGACCACCGCAATCGCGGCCATC 3'
Verma (2017)
Designed for isolation of laccase gene from Pseudomonas putida
Tmr F
Tmr R
5′GATAGGAGGCATTCACCTTG 3'
5′AGACTCTATGGATGCGCGCG3'
Jang et al (2005)
Designed for isolation of tmr gene from Citrobacter sp. KCTC 186,611