From: Decolorization of Malachite green dye by Stenotrophomonas maltophilia a compost bacterium
Primers | Sequences | References |
---|---|---|
Lac F Lac R | 5′ATGTCCTTTACCCGTCGACAAATGC 3' 5′TCAGACCACCGCAATCGCGGCCATC 3' | Verma (2017) Designed for isolation of laccase gene from Pseudomonas putida |
Tmr F Tmr R | 5′GATAGGAGGCATTCACCTTG 3' 5′AGACTCTATGGATGCGCGCG3' | Jang et al (2005) Designed for isolation of tmr gene from Citrobacter sp. KCTC 186,611 |