Skip to main content

Table 2 Sequences (5′–3′) of adapters and primers used in adjusted AFLP for the within and between population studies and sequences (5′–3′) of primers used for the sequencing of the conserved region of EPSP. Data in boldface shows the most informative primers in terms of number of bands and polymorphisms

From: Genetic diversity and spread of glyphosate-resistant flaxleaf fleabane

Adapters
MseIMseI adapter 1
MseI adapter 2
GACGATGAGTCCTGAG
TACTCAGGACTCAT
PstIPstI adapter 1
PstI adapter 2
CTCGTAGACTGCGTACATGCA
TGTACGCAGTCTAC
Pre-amplification primers
PstI pre-selective primer APstI + A primerGACTGCGTACATGCAG-A
MseI pre-selective primer CMseI + C primerGATGAGTCCTGAGTAA-C
Selective amplification primers
PstI selective primer ATCPstI+ATC primerGACTGCGTACATGCAG-ATC
MseI selective primer CAG + (TET)MseI + CAG Fluro (TET) primerGATGAGTCCTGAGTAA-CAG
MseI selective primer CAC + (NED)MseI + CAC Fluro (NED) primer═ -CAC
MseI selective primer CAT + (FAM)MseI + CAT Fluro (FAM) primer═ -CAT
MseI selective primer CAA + (VIC)MseI + CAA Fluro (VIC) primer═ -CAA
MseI selective primer CC + PstI + primer ACMseI + CC primer + PstI + AC primer(GATGAGTCCTGAGTAA-CC+ GACTGCGTACATGCAG-AC)
MseI selective primer CC + PstI + primer AGMseI + CC primer + PstI + AG primer(GATGAGTCCTGAGTAA-CC + GACTGCGTACATGCAG-AG)
EPSPS primers
 Forward primer
 Reverse primer
Lr-EPSP_F
Lr-EPSP_R
TGCAAAAAGAGCTGTAGTCGTTGGCT
AGTTGTTTCAAACCGACAACTAAGTC