Skip to main content

Table 2 Sequences (5′–3′) of adapters and primers used in adjusted AFLP for the within and between population studies and sequences (5′–3′) of primers used for the sequencing of the conserved region of EPSP. Data in boldface shows the most informative primers in terms of number of bands and polymorphisms

From: Genetic diversity and spread of glyphosate-resistant flaxleaf fleabane

Adapters
MseI MseI adapter 1
MseI adapter 2
GACGATGAGTCCTGAG
TACTCAGGACTCAT
PstI PstI adapter 1
PstI adapter 2
CTCGTAGACTGCGTACATGCA
TGTACGCAGTCTAC
Pre-amplification primers
PstI pre-selective primer A PstI + A primer GACTGCGTACATGCAG-A
MseI pre-selective primer C MseI + C primer GATGAGTCCTGAGTAA-C
Selective amplification primers
PstI selective primer ATC PstI+ATC primer GACTGCGTACATGCAG-ATC
MseI selective primer CAG + (TET) MseI + CAG Fluro (TET) primer GATGAGTCCTGAGTAA-CAG
MseI selective primer CAC + (NED) MseI + CAC Fluro (NED) primer ═ -CAC
MseI selective primer CAT + (FAM) MseI + CAT Fluro (FAM) primer ═ -CAT
MseI selective primer CAA + (VIC) MseI + CAA Fluro (VIC) primer ═ -CAA
MseI selective primer CC + PstI + primer AC MseI + CC primer + PstI + AC primer (GATGAGTCCTGAGTAA-CC+ GACTGCGTACATGCAG-AC)
MseI selective primer CC + PstI + primer AG MseI + CC primer + PstI + AG primer (GATGAGTCCTGAGTAA-CC + GACTGCGTACATGCAG-AG)
EPSPS primers
 Forward primer
 Reverse primer
Lr-EPSP_F
Lr-EPSP_R
TGCAAAAAGAGCTGTAGTCGTTGGCT
AGTTGTTTCAAACCGACAACTAAGTC