Skip to main content

Table 1 Primers used for PCR amplification of qnr genes

From: High prevalence of qnrA and qnrB genes among fluoroquinolone-resistant Escherichia coli isolates from a tertiary hospital in Southern Nigeria

Target gene Primer sequence (5′-3′) Size (bp)
qnrA F: GATAAAGTTTTTCAGCAAGAGG
R: ATCCAGATCCGCAAAGGTTA
823
qnrB F: ATGACGCCATTACTGTATAA
R: GATCGCAATGTGTGAAGTTT
408
qnrS F: ATGGAAACCTACAATCATAC
R: AAAAACACCTCGACTTAAGT
428
\