Skip to main content
Bulletin of the National Research Centre
Fig. 2 | Bulletin of the National Research Centre

Fig. 2

From: MAOA-uVNTR variations in schizophrenia: case and control study

Fig. 2

Sequencing examination of MAOA-uVNTR polymorphism PCR products. a 3.5 repeat genotype sequenced by forward primer. A 30 bp "ACCGGCACCGGCACCAGTACCCGCACCAGT" sequence shows a complete repeat and "ACCGGCACCGGCACC" sequence depicts half of repeat. b 3 repeat genotype sequencing analysis performed by reverse primer. c 4 repeat genotype sequencing analysis performed by reverse primer

Back to article page