Skip to main content

Table 1 Primers for Quinolone Resistant genes A, B, D and S

From: Multidrug resistant E. coli recovered from household reared female budgerigar pet bird (Melopsittacus undulatus) in Ibadan, Oyo State Nigeria: a case report

Primers Expected band size (bp) Annealing temperature (°C) References
QNRA-F ATTTCTCACGCCAGGATTTG
R GATCGGCAAAGGTTAGGTCA
516 55 Robicsek et al. (2006)
QNRB-F GATCGTGAAAGCCAGAAAGG
R-ACGATGCCTGGTAGTTGTCC
469 49 Robicsek et al. (2006)
QNRD-F-CGAGATCAATTTACGGGGAATA
R-AACAAGCTGAAGCGCCTG
582 53 Pribul et al. (2017)
QNRS-F – ACGACATTCGTCAACTGCAA
R -TAAATTGGCACCCTGTAGGC
417 53 Robicsek et al. (2006)