Skip to main content

Table 2 The specific primer sequences of BADH-1 and Actin genes

From: Genetic and biochemical studies on some Egyptian wheat genotypes under drought stress

Primer Forward primer (5′–3′) Reverse primer (5′–3′) Expected size of amplicon
BADH-1 CAGCAAGAAGTGAAGGTGCTAC GTACCTGGTGACTTGTTTCACG ~ 410 bp
Actin primer CTGGGATGACATGGGGAAAATATGGCA GCCTTGGAGATCCACATCTGCTGGA ~ 850 bp