Skip to main content

Table 1 Oligonucleotide primers used for PCR amplification

From: Phenotypic characterization of the Egyptian isolates “extensively drug-resistant Pseudomonas aeruginosa” and detection of their metallo-β-lactamases encoding genes

Gene (5′–3′)a Product size PCR conditions Reference
16S rDNA F–GGGGGATCTTCGGACCTCA
R–TCCTTAGAGTGCCCACCCG
956 Initial denaturation at 95 °C (2 min), with 25 cycles of denaturation at 94 °C for 20 s, annealing at 58 °C for 20 s, and extension at 72 °C for 40 s and final extension at 72 °C for 1 min Spilker et al. 2004
NDM-1 F–ACTTCCTATCTCGACATGC
R–TGATCCAGTTGAGGATCTG
133 Initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 30 s at 55 °C for (VIM-1,VIM-2) and 52 °C for NDM-1, extension at 72 °C for 30 s after this step final extension at 72 °C for 5 min Shaaban et al. 2017
VIM-1 F–TGTTATGGAGCAGCAACGATG
R–AAAGTCCCGCTCCAACGATT
920
VIM-2 F–GTCTATTTGACCGCGTCTATC
R–CTACTCAACGACTGAGCGAT
774
IMP F–GGAATAGAGTGGCTTAAYTCTC
R–GGTTTAAYAAAACAACCACC
232 10 min at 94 °C and 36 cycles of amplification consisting of 30 s at 94 °C, 40 s at 52 °C, and 50 s at 72 °C, ending with a final extension period of 5 min at 72 °C Poirel et al. 2011
  1. aY = C or T