Table 1 Oligonucleotide primers used for PCR amplification
Gene | (5′–3′)a | Product size | PCR conditions | Reference |
|---|---|---|---|---|
16S rDNA | F–GGGGGATCTTCGGACCTCA R–TCCTTAGAGTGCCCACCCG | 956 | Initial denaturation at 95 °C (2 min), with 25 cycles of denaturation at 94 °C for 20 s, annealing at 58 °C for 20 s, and extension at 72 °C for 40 s and final extension at 72 °C for 1 min | Spilker et al. 2004 |
NDM-1 | F–ACTTCCTATCTCGACATGC R–TGATCCAGTTGAGGATCTG | 133 | Initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 30 s at 55 °C for (VIM-1,VIM-2) and 52 °C for NDM-1, extension at 72 °C for 30 s after this step final extension at 72 °C for 5 min | Shaaban et al. 2017 |
VIM-1 | F–TGTTATGGAGCAGCAACGATG R–AAAGTCCCGCTCCAACGATT | 920 | ||
VIM-2 | F–GTCTATTTGACCGCGTCTATC R–CTACTCAACGACTGAGCGAT | 774 | ||
IMP | F–GGAATAGAGTGGCTTAAYTCTC R–GGTTTAAYAAAACAACCACC | 232 | 10 min at 94 °C and 36 cycles of amplification consisting of 30 s at 94 °C, 40 s at 52 °C, and 50 s at 72 °C, ending with a final extension period of 5 min at 72 °C | Poirel et al. 2011 |