Skip to main content

Table 1 ISSR-PCR primers used for the genotyping of Moringa

From: The influence of He-Ne laser on agro-morphological criteria, ISSR marker and SDS-PAGE of Moringa oleifera

Name primerSequence (5′-3′) 
ISSR-6CGCGATAGATAGATAGATACGC(GATA)4
ISSR-7GACGATAGATAGATAGATAGAC(GATA)4
ISSR-8AGACAGACAGACAGACGC(AGAC)4GC
ISSR-9GATAGATAGATAGATAGC(GATA)4GC
ISSR-10GACAGACAGACAGACAAT(GACA)4AT
ISSR-11ACACACACACACACACYA(AC)8YA
ISSR-12ACACACACACACACACYC(AC)8YC
ISSR-13AGAGAGAGAGAGAGAGT(AG)8T
ISSR-16TCTCTCTCTCTCTCTCTA(TC)8TA
ISSR-HB09GTGTGTGTGTGTGC(GT)6GC
ISSR-HB-13GAGGAGGAGGC(GAG)3GC
ISSR-HB14GTGGTGGTGGC(GTG)3GC
  1. A adenine, T thymine, G guanine, C cytosine