Skip to main content

Table 1 Name, accession number, primer sequence, and product size for genes used for real-time PCR analysis

From: Seasonal assessment of some heavy metal pollution and Metallothionein gene expression in cultured Oreochromis niloticus

Gene Accession number Nucleotide sequence 5′–3′ Size of PCR product (bp)
Metallothionein XM_003447045.5 CTGCAACTGCGGAGGA
GGTGTCGCATGTCTTTCCTT
136
β-Actin XM_003443127.5 TGTGTGGTGTGTGGTTGTTTTG
CAGCAAGCAGGAGTACGATGAG
136