Skip to main content

Table 1 Guide sequences of genes under study

From: Generation of CRISPR-cas9 construct for knockout of genes encoding chromatin-associated proteins

S. no. Name of the target gene No. of guides Name of guides Guide sequence 5′ to 3’
01. ISWI 03 ISWI19, ISWI20, ISWI21, ISWI22 and ISWI23 TTCGACGGCAGCTGTATCTGTT, TTCGGGTCTACCCTTAGGCTTCGT, TTCGATATCTCCGTCTGCTTTAGC, TTCGCTTTTCACCGGATGAACTGG, TTCGTAAGAGTCCCACGAAGCCTA
02. Acf 02 Acf10 and Acf11 TTCGCCTTCGGGCACCCGTCCTTC, TTCGGGTGTTGACCGCCGACTGTT
03. Pc 02 Pc1, Pc2 TTCGGCCGCGTACACTAGATCGAC, TTCGTCCAGTCGATCTAGTGTACG
04. Psc 02 Psc8 and Psc9 TTCGGGCTGTATTGCTTTCGATTC, TTCGGACAACGGCAACGAATAAGG