Skip to main content

Table 3 Amplification products generated with SSR markers among mother plant and in vitro raised plants

From: Analysis of diversity using simple sequence repeat (SSR): distinctions between original Parmentiera cereifera tree and somaclones

Primers Forward primer (5′ → 3′) Reverse primer (5′ → 3′) A B C
SSR1 GTGAGCAATTTTGATTATACTG TACCCTGATGCTGTAATATGTG 2 2 0
SSR2 TCTGGCCAGGATCAATATTACT TAAGATACATAGATCCAACACC 2 1 1
SSR3 GGTCTTCTGGGCTTTGATCCTG TGTTGCTAGGGACCCGTAGTGG 2 2 0
SSR4 GAAACAGGGTTAACCATGCCAA ATGGTGCTGCCAACAACATACA 1 1 0
SSR5 GAGGGTTCTGAAATGTTTTGCC ACGTGCTAGGGAGGTATCTTGC 3 3 0
SSR6 CTCATGAGTATATCACCGCACA GACGCGAAACGAATATTCAAGT 2 1 1
SSR7 TTATCTTGGTGTCTCATGTCAG TCGCAAGATCATCAGAACAGTA 1 1 0
SSR8 TCCAATCAATCAGGGAGGAGTA GAACGCATCAAGGCATGAAGTA 3 2 1
SSR9 TTCTAAAATGTTTGAAACGCTC GCATTTCGATATGTTGAAGTAA 2 1 1
SSR10 GTTTTTGTGATCCCGGGTTT CATGCGTCAGTTCAAGTTTT 2 2 0
SSR11 GTCCATATATGCAAGGAGTC GTACTCTATCGCAAAACACA 1 1 0
SSR12 AATGTCATGCGTGTAGTAGCCA AAGCGCACTTAACAGAAGAGGG 1 1 0
SSR13 GCCTCTAGGGAGAAAACTAACA TCAAGATCATATCCTCCCCAAC 3 3 0
SSR14 ATAAAGCTGTCTCTTTAGTTCG GTTTTAACACATATGCATACCT 2 2 0
SSR15 AGTGGTAATGAGGTGAAAGAAG TCGGTCGTATATGCATGTAAAG 2 2 0
SSR16 AACACAAAAGATCCAACGACAC CAGTATAGAAGGATTTTGAGAG 3 2 1
SSR17 TACCCGAATCTGGAAAATCAAT TGGAAGCTTGCTAACTTTGGAG 1 1 0
SSR18 TGCAGTTGCGGATCCTTGA TAACCAAGCAGCACGTATT 1 0 1
SSR19 AGGGCTCTCTTTAATTCTTGCT GGTCTATCGTAATCCACCTGTA 1 1 0
SSR20 TCCTTGACCCCTTGCACTAACT ATGGTTGGGAGCACTAGCTTGG 1 0 1
SSR21 GTATCTCACGAGCATAACACAA GAAAGTGTATGGATCATTAGGC 2 2 0
SSR22 ATTTTCTCAAACACACCCCG TAGCAGATGTTGACAATGGA 2 1 1
SSR23 ACGTATCCAGACACTGTGGTAA TAATGGTGGATCCATGATAGCC 1 1 0
SSR24 GAGATTTGTTCATTTCATCTTCGCA TATATTAAAGGTTAGAGGTAGTCAG 1 1 0
SSR25 GACGTCAAGAATCTTCGTCGGA ATCTGCTGAGCAGATCGTGGTT 2 2 0
SSR26 GCTCAGATCATCCACCAACTTC AGATGCTCTGGGAGAGTCCTTA 2 2 0
SSR27 AGTAATCTGGTCCTCTCTTCTTCT AGGTAATCTCCGAGTGCACTTCAT 1 1 0
SSR28 CCAAATCTTCGAACAAGAACCC ACCGATCGATGGTGTATACTGA 2 2 0
SSR29 GCTTTAACAAAGATCCAAGTGGCAT GTAAACATCCAAACAAAGTCGAACG 1 1 0
SSR30 CTCCATCTATTGAGCGAAGGTT CAAGATGAAGCTCATGCAAGTG 1 1 0
SSR31 GTGGATAACATCATGGTCAAC TACTTCGCACTAGATGAGCCT 2 2 0
SSR32 TCAGGCCATGTATTATGCAGTA ACGACCAGGATAGCCAATTCAA 2 2 0
SSR33 AGTTATGTATTCTCTCGAGCCTG GGTAACCACTAGAGTATGTCCTT 1 1 0
SSR34 GACATGTGCACCAGAATAGC AGAAGAACTATTCGACTCCT 2 2 0
SSR35 GGAGCATCGCAGGACAGA GGACGAGGACGCCTGAAT 2 2 0
SSR36 TGCGGTACAGGCAAGGCT TAGAACGCCCTCGTCGGA 1 0 1
SSR37 ACAAAGGTGCATTCGTAGA AACACGCATCAGTTTCAGT 1 1 0
SSR38 CCTGTTGCATACTTGACCTTTTT GGAGTTCAATCTTTCATCACCAT 2 2 0
Total 64 55 9
Mean 1.68 1.45 0.236
Maximal 3   2
Minimal 1   0
  1. A = number of scorable bands, B = monomorphic bands, C = polymorphic bands